ID: 924216179_924216182

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 924216179 924216182
Species Human (GRCh38) Human (GRCh38)
Location 1:241824695-241824717 1:241824717-241824739
Sequence CCAGCAAGGGGTAGAGGCACTCC CTGGAGCCACAGCTCAAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!