ID: 924250933_924250935

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 924250933 924250935
Species Human (GRCh38) Human (GRCh38)
Location 1:242132496-242132518 1:242132539-242132561
Sequence CCTGCAACTGGGAGCAGCTCACA TTTATATTCTGAGTTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 193} {0: 1, 1: 0, 2: 2, 3: 19, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!