ID: 924268599_924268612 |
View in Genome Browser |
Spacer: 22 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 924268599 | 924268612 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:242308889-242308911 | 1:242308934-242308956 |
| Sequence | CCATGTATCCTCTTCTGCACTCG | GTGTGGGAGGGGAGGATGGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 2, 2: 20, 3: 263, 4: 4010} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||