ID: 924268600_924268612

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 924268600 924268612
Species Human (GRCh38) Human (GRCh38)
Location 1:242308897-242308919 1:242308934-242308956
Sequence CCTCTTCTGCACTCGTTATTTTG GTGTGGGAGGGGAGGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180} {0: 2, 1: 2, 2: 20, 3: 263, 4: 4010}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!