ID: 924270784_924270789

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924270784 924270789
Species Human (GRCh38) Human (GRCh38)
Location 1:242330349-242330371 1:242330402-242330424
Sequence CCATTCTGTGACAACATTGAGCC GTGGCCCTTACTTGGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108} {0: 1, 1: 1, 2: 0, 3: 7, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!