ID: 924270914_924270917

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 924270914 924270917
Species Human (GRCh38) Human (GRCh38)
Location 1:242331820-242331842 1:242331842-242331864
Sequence CCTAGAGTGCCCTGTGCATAATA ATTCTTAATAGATTAAAACTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 104} {0: 1, 1: 1, 2: 3, 3: 43, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!