ID: 924328681_924328695

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 924328681 924328695
Species Human (GRCh38) Human (GRCh38)
Location 1:242921215-242921237 1:242921256-242921278
Sequence CCTCAAACCCATCTCCCTAAGGA TAAGGGAATTATAGAAGGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!