ID: 924345330_924345337

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 924345330 924345337
Species Human (GRCh38) Human (GRCh38)
Location 1:243068301-243068323 1:243068341-243068363
Sequence CCAAAAAAAGAAACATTAGCCAG ACCCGTAGTTCCAGCTACTTGGG
Strand - +
Off-target summary No data {0: 25, 1: 987, 2: 20064, 3: 110438, 4: 252345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!