ID: 924345330_924345342

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 924345330 924345342
Species Human (GRCh38) Human (GRCh38)
Location 1:243068301-243068323 1:243068350-243068372
Sequence CCAAAAAAAGAAACATTAGCCAG TCCAGCTACTTGGGAGTCTGGGG
Strand - +
Off-target summary No data {0: 85, 1: 6786, 2: 109153, 3: 219239, 4: 254838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!