ID: 924345330_924345344

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 924345330 924345344
Species Human (GRCh38) Human (GRCh38)
Location 1:243068301-243068323 1:243068353-243068375
Sequence CCAAAAAAAGAAACATTAGCCAG AGCTACTTGGGAGTCTGGGGTGG
Strand - +
Off-target summary No data {0: 33, 1: 496, 2: 14727, 3: 30337, 4: 46849}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!