ID: 924345330_924345345

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924345330 924345345
Species Human (GRCh38) Human (GRCh38)
Location 1:243068301-243068323 1:243068354-243068376
Sequence CCAAAAAAAGAAACATTAGCCAG GCTACTTGGGAGTCTGGGGTGGG
Strand - +
Off-target summary No data {0: 31, 1: 494, 2: 16352, 3: 113220, 4: 215481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!