ID: 924345335_924345346

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924345335 924345346
Species Human (GRCh38) Human (GRCh38)
Location 1:243068320-243068342 1:243068373-243068395
Sequence CCAGGTGTGGTGGTGGTGCACAC TGGGAGAAATCCCTTGAGCCTGG
Strand - +
Off-target summary No data {0: 17, 1: 2, 2: 12, 3: 88, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!