ID: 924353714_924353720

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 924353714 924353720
Species Human (GRCh38) Human (GRCh38)
Location 1:243146972-243146994 1:243146987-243147009
Sequence CCAATTGTGAATCCCCCATCTAG CCATCTAGAGGCACTCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 69} {0: 1, 1: 1, 2: 7, 3: 7, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!