ID: 924380748_924380760

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 924380748 924380760
Species Human (GRCh38) Human (GRCh38)
Location 1:243462080-243462102 1:243462122-243462144
Sequence CCCTCTCTCCACCACTTCTCAAC GAGGGAATGAAGGGGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 619} {0: 1, 1: 0, 2: 8, 3: 49, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!