ID: 924380753_924380760

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 924380753 924380760
Species Human (GRCh38) Human (GRCh38)
Location 1:243462103-243462125 1:243462122-243462144
Sequence CCTGCATCAGTGTAGCACAGAGG GAGGGAATGAAGGGGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124} {0: 1, 1: 0, 2: 8, 3: 49, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!