ID: 924385174_924385181

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 924385174 924385181
Species Human (GRCh38) Human (GRCh38)
Location 1:243493127-243493149 1:243493165-243493187
Sequence CCCTGGCCTGTCTTTTGTTTGAG CGCACTCTCGCCCTCTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 290} {0: 1, 1: 0, 2: 1, 3: 2, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!