ID: 924386730_924386748

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924386730 924386748
Species Human (GRCh38) Human (GRCh38)
Location 1:243506167-243506189 1:243506220-243506242
Sequence CCCGTCAGGCCCAAGGACCGCAG GCCTCACAGTCTCCTGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124} {0: 1, 1: 0, 2: 6, 3: 36, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!