ID: 924436709_924436732

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 924436709 924436732
Species Human (GRCh38) Human (GRCh38)
Location 1:244049007-244049029 1:244049044-244049066
Sequence CCGGCCCCTGGCCCCTGACCTGG CCCGGCACCCCGGCGGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 131, 4: 1005} {0: 1, 1: 0, 2: 4, 3: 61, 4: 1316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!