ID: 924458672_924458677

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 924458672 924458677
Species Human (GRCh38) Human (GRCh38)
Location 1:244238822-244238844 1:244238844-244238866
Sequence CCTTCTTCCATTAGTGAAGAAAG GTATATTTAGCTGGGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!