ID: 924458673_924458679

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 924458673 924458679
Species Human (GRCh38) Human (GRCh38)
Location 1:244238829-244238851 1:244238872-244238894
Sequence CCATTAGTGAAGAAAGTATATTT GCCTATAATCCCAGCACTTTGGG
Strand - +
Off-target summary No data {0: 20309, 1: 245873, 2: 272109, 3: 175034, 4: 144323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!