ID: 924500683_924500690

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 924500683 924500690
Species Human (GRCh38) Human (GRCh38)
Location 1:244635622-244635644 1:244635643-244635665
Sequence CCCCCGTGTCTCCCAGAAGCAGC GCCTGTGCACTCACTTTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 213} {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!