ID: 924516327_924516335

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 924516327 924516335
Species Human (GRCh38) Human (GRCh38)
Location 1:244769035-244769057 1:244769068-244769090
Sequence CCCCAAGCACACAGGTTCTCTTT CGGCCACTGTTAGGAGATTGGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 52, 3: 133, 4: 473} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!