ID: 924539914_924539928

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 924539914 924539928
Species Human (GRCh38) Human (GRCh38)
Location 1:244970787-244970809 1:244970825-244970847
Sequence CCCTCCCTCGGAGGCCGGGCCTT TGCGCCGGAGGCGCCGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137} {0: 1, 1: 0, 2: 1, 3: 20, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!