ID: 924548781_924548787

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 924548781 924548787
Species Human (GRCh38) Human (GRCh38)
Location 1:245054673-245054695 1:245054717-245054739
Sequence CCTTCTCTTTCCCAGCCAATACA TGCTCCTGTGGCTTCATGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 341} {0: 1, 1: 0, 2: 2, 3: 17, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!