|
Left Crispr |
Right Crispr |
| Crispr ID |
924552993 |
924553001 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:245095640-245095662
|
1:245095663-245095685
|
| Sequence |
CCACCTTGGCCTCCCAAAGAACC |
GGGATTAGAGCCACCACACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 84, 2: 3809, 3: 68025, 4: 160044} |
{0: 1, 1: 19, 2: 62, 3: 210, 4: 1315} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|