ID: 924560831_924560841

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 924560831 924560841
Species Human (GRCh38) Human (GRCh38)
Location 1:245155588-245155610 1:245155611-245155633
Sequence CCGCTGCAGAGGCGCCCCCGGGG CTGGCGGGGTTGTGAGTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 212} {0: 1, 1: 0, 2: 2, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!