ID: 924569258_924569266

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 924569258 924569266
Species Human (GRCh38) Human (GRCh38)
Location 1:245223166-245223188 1:245223208-245223230
Sequence CCCCCACCACAGAGAATCAGCTA CTGAAGCTGAGAACCCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 316} {0: 1, 1: 0, 2: 3, 3: 21, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!