ID: 924580655_924580664

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 924580655 924580664
Species Human (GRCh38) Human (GRCh38)
Location 1:245321133-245321155 1:245321169-245321191
Sequence CCCTGTTCTCTCTCTATTCATCC CCCTCATCCCTGGCAGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 735} {0: 1, 1: 0, 2: 2, 3: 45, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!