ID: 924598702_924598708

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 924598702 924598708
Species Human (GRCh38) Human (GRCh38)
Location 1:245469181-245469203 1:245469218-245469240
Sequence CCTGGAGTCTTCCTACTGCACTC CCAGAGAAACAGCGTCACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174} {0: 1, 1: 1, 2: 1, 3: 12, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!