|
Left Crispr |
Right Crispr |
| Crispr ID |
924599503 |
924599505 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:245476071-245476093
|
1:245476093-245476115
|
| Sequence |
CCACAAAAAGGAATAAAGTGCTG |
GATGCATGCTGCCATGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 16, 2: 152, 3: 652, 4: 2276} |
{0: 1, 1: 0, 2: 2, 3: 34, 4: 270} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|