ID: 924611110_924611115

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 924611110 924611115
Species Human (GRCh38) Human (GRCh38)
Location 1:245574574-245574596 1:245574612-245574634
Sequence CCTGGAAGGTTCTGGAGTTCAGG CCTTCTGCCCCTCAAGTCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 205} {0: 1, 1: 0, 2: 2, 3: 22, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!