ID: 924613143_924613152 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 924613143 | 924613152 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:245590229-245590251 | 1:245590246-245590268 |
| Sequence | CCCCTGGCCGCACCGTGCCGCGC | CCGCGCATGCGCAGGGTCCCGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 3, 2: 8, 3: 27, 4: 153} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||