ID: 924616721_924616732

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 924616721 924616732
Species Human (GRCh38) Human (GRCh38)
Location 1:245618033-245618055 1:245618063-245618085
Sequence CCTCCCACCAAAGTCAGGGTTAC AGAGAAGGAGGCAGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91} {0: 1, 1: 92, 2: 1497, 3: 10735, 4: 23782}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!