ID: 924616723_924616735 |
View in Genome Browser |
Spacer: 15 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 924616723 | 924616735 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:245618037-245618059 | 1:245618075-245618097 |
| Sequence | CCACCAAAGTCAGGGTTACAGAA | AGGGAGGGAGGGAAAAGGAAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 38, 2: 295, 3: 1773, 4: 9203} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||