ID: 924616725_924616736

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 924616725 924616736
Species Human (GRCh38) Human (GRCh38)
Location 1:245618040-245618062 1:245618080-245618102
Sequence CCAAAGTCAGGGTTACAGAAGGA GGGAGGGAAAAGGAAAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 204} {0: 3, 1: 21, 2: 285, 3: 1940, 4: 11865}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!