ID: 924625595_924625599

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 924625595 924625599
Species Human (GRCh38) Human (GRCh38)
Location 1:245694665-245694687 1:245694678-245694700
Sequence CCCCTCTGACTGCACGCAGCTGT ACGCAGCTGTCAGCCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155} {0: 1, 1: 0, 2: 0, 3: 34, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!