ID: 924630584_924630588

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 924630584 924630588
Species Human (GRCh38) Human (GRCh38)
Location 1:245736452-245736474 1:245736470-245736492
Sequence CCACGAACTTGGTGGTTCTGGCA TGGCAGAAACAATATGGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!