ID: 924701379_924701382

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 924701379 924701382
Species Human (GRCh38) Human (GRCh38)
Location 1:246456929-246456951 1:246456946-246456968
Sequence CCAGACTAATCCAAATCTGGCTC TGGCTCTAGGTTAAAGAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!