ID: 924709909_924709915

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 924709909 924709915
Species Human (GRCh38) Human (GRCh38)
Location 1:246523245-246523267 1:246523284-246523306
Sequence CCATACAGGGTGTGGGGGGCTTC GAGAAAGAACAGGAGAACTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 34, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!