ID: 924715089_924715097

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 924715089 924715097
Species Human (GRCh38) Human (GRCh38)
Location 1:246566058-246566080 1:246566092-246566114
Sequence CCCTAAAATGCAAAAGCGACCAG GCGGAGAGCCTCAGCCGCCGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 136} {0: 1, 1: 0, 2: 2, 3: 13, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!