|
Left Crispr |
Right Crispr |
| Crispr ID |
924719037 |
924719043 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:246605857-246605879
|
1:246605892-246605914
|
| Sequence |
CCGGCCGGCCCTCTTCCTGCTTC |
ACGCGCGCTGCTGGTGCAAGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 12, 2: 51, 3: 84, 4: 486} |
{0: 3, 1: 1, 2: 18, 3: 12, 4: 72} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|