|
Left Crispr |
Right Crispr |
Crispr ID |
924724522 |
924724528 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:246656814-246656836
|
1:246656838-246656860
|
Sequence |
CCCAGCTACAGGAGGCTAAGGTG |
GAGGATTGCTTGAGCCTAGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 19, 2: 33, 3: 148, 4: 456} |
{0: 390, 1: 5963, 2: 19283, 3: 75879, 4: 148306} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|