ID: 924732908_924732911

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 924732908 924732911
Species Human (GRCh38) Human (GRCh38)
Location 1:246728452-246728474 1:246728485-246728507
Sequence CCTGAACATGAGTAACACAGTGT AAATGTATCCCCCTGCTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119} {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!