ID: 924783403_924783405

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 924783403 924783405
Species Human (GRCh38) Human (GRCh38)
Location 1:247172115-247172137 1:247172143-247172165
Sequence CCCTCAGACTCTTAGTGACAGGT CTCCCGCGCGTGTCTGAATGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 94} {0: 2, 1: 0, 2: 0, 3: 3, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!