ID: 924788089_924788096 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 924788089 | 924788096 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:247219052-247219074 | 1:247219094-247219116 |
| Sequence | CCTGGATAGTCCTTTGGGGAGAT | CAACCCTCGAACCAGGGACAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 10, 2: 6, 3: 15, 4: 103} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||