ID: 924798241_924798248

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 924798241 924798248
Species Human (GRCh38) Human (GRCh38)
Location 1:247308548-247308570 1:247308586-247308608
Sequence CCTTCTTTCTTCTACCTGGAATG AGTCTTTCCAGAGGAGGAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 66, 4: 436} {0: 1, 1: 0, 2: 5, 3: 43, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!