ID: 924813669_924813674

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 924813669 924813674
Species Human (GRCh38) Human (GRCh38)
Location 1:247424677-247424699 1:247424707-247424729
Sequence CCCCTGGTCTGCTGGATCGTGTG CTGAAACAGCAGATGGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110} {0: 1, 1: 1, 2: 5, 3: 34, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!