|
Left Crispr |
Right Crispr |
Crispr ID |
924828724 |
924828727 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:247570055-247570077
|
1:247570100-247570122
|
Sequence |
CCCTCTATTATTTTTTAGTGTGT |
TTCATTATTAGTCTGGCTAGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 100, 3: 3333, 4: 4296} |
{0: 2, 1: 568, 2: 5884, 3: 2786, 4: 1941} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|