ID: 924876768_924876774

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 924876768 924876774
Species Human (GRCh38) Human (GRCh38)
Location 1:248114917-248114939 1:248114949-248114971
Sequence CCACACATATCCACGCAGTCAGT TGTGTGTGGTCCCCATTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 3, 3: 77, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!