ID: 924883546_924883551

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 924883546 924883551
Species Human (GRCh38) Human (GRCh38)
Location 1:248188519-248188541 1:248188532-248188554
Sequence CCAGTGCACCTCCCTCTCTGAGC CTCTCTGAGCAGAAGCAGGATGG
Strand - +
Off-target summary {0: 15, 1: 2, 2: 4, 3: 29, 4: 299} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!